 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| CircCEP128 | |||
| Gene | CEP128 | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Bladder Cancer | ICD-10 | Malignant neoplasm of Bladder, unspecified (C67.9) |
| DBLink | Link to database | PMID | 30134837 |
| Experimental Method | |||
| Sample Type | Tissues and Cell lines | Comparison | Ten pairs of bladder tumor tissues and adjacent bladder tissues |
| Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
| Primers (Experimented) | Forward ACCCACATCGCTGGTTAGC ReverseTCGATCACCTTCTGCTTTCGT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Wu, Z, Huang, W, Wang, X, Wang, T, Chen, Y, Chen, B, Liu, R, Bai, P, Xing, J (2018). Circular RNA CEP128 acts as a sponge of miR-145-5p in promoting the bladder cancer progression via regulating SOX11. Mol. Med., 24, 1:40. | |||